El circo grotesco de las células tumorales: los enanos

The clowns of Bertam Mills Circus in 1932 (Bibliothèque Nationale de France) Fuente.

Cuando hablamos de genómica los números que se suelen manejar son grandes. Por ejemplo, el genoma humano tiene unos 3.000.000.000 de pares de bases (o nucleótidos, las letras que forman nuestro ADN), una pequeña parte de los cuales conforma los aproximadamente 20.000 genes que lo componen. Estos genes tienen un tamaño medio superior a los 60.000 nucleótidos, aunque algunos llegan a los 2.500.000 pares de bases.

Por eso resulta sorprendente que la expresión de estos enormes genes dependa de secuencias muy muy muy pequeñas: se trata de los microARN, secuencias de ARN de tan solo unos 20 nucleótidos que deciden qué gen se va a expresar, cuándo y dónde. El ARN (ácido ribonucleico) sería una secuencia de nucléotidos similar al ADN, excepto por el uso de ribosa (R) en lugar de desoxirribosa (D), que suele presentarse en forma de una única hebra (el ADN suele formar una doble hélice) y que como bases nitrogenadas usa adenina, citosina, guanina y uracilo (ACGU, el ADN usa timina en lugar de uracilo, ACGT).

Fuente

Vamos a ver qué influencia tienen estos enanos en el circo grotesco de las células tumorales.

Descubrimiento del primer microARN: lin-4

El nemátodo (gusano, para los amigos) Caenorhabditis elegans (C. elegans), uno de los organismos modelo más utilizados en investigación, pasa por cuatro fases larvarias antes de llegar a la edad adulta. Hace unos 25 años se descubrió una pequeña secuencia de ARN de tan solo 22 nucleótidos, a la que se llamó lin-4, que era fundamental para una transición adecuada entre las fases larvarias: si se inhibía la expresión de esta secuencia, muchas células del C. elegans se mantenían en la fase 1, por lo que el animal adulto sufría problemas de coordinación, malformaciones, incapacidad para poner huevos, etc. Os presento a lin-4:

UCCCUGAGACCUCAAGUGUGA

Los investigadores descubrieron que lin-4 actuaba inhibiendo (más tarde explicaré cómo) la expresión de la proteína lin-14 (vale, igual no eran muy originales poniendo nombres), que se acumulaba en las células en ausencia de lin-4 causando los problemas de desarrollo larvario anteriormente mencionados.

Ciclo de vida del C. elegans. El microARN lin-4 regula el paso de la fase larvaria L1 a las fases siguientes (fuente)

El enano letal

Siete años después del hallazgo de lin-4 se encontró, también en C. elegans, un nuevo microRNA de tan sólo 22 nucleótidos que afectaba también al desarrollo del gusano, esta vez de la fase larvaria L4 al adulto. Debido a que su represión daba lugar a gusanos adultos con terribles deformidades y que morían pronto, se le llamó lethal-7 (let-7).

Enano letal tras acabar con su última víctima (New Jersey, 1958. Visto en Reddit).

Pero lo más curioso de let-7 es que se ha encontrado en todos los animales y su secuencia se conserva, es decir, es la misma en todos los seres vivos, lo cual es un indicativo de que su función debe de ser muy importante. En humanos se ha detectado en prácticamente todos los tipos de tejidos.

Secuencia del miARN let-7 en lobo, mosca, ratón y humanos (de arriba a abajo). La zona recuadrada indica la secuencia común de diferentes miembros de la familia let-7. Imagen adaptada de esta fuente.

Desde entonces se han descubierto miles de microARNs en todo tipo de especies vivas, dirigiendo importantes procesos celulares. Y esto lo consiguen regulando negativamente la expresión génica a nivel post-transcripcional. Si no has entendido nada de la frase anterior, no te preocupes; ahora lo explicamos.

¿Post-transcriqué? ¿Expresión génica?

Los genes son fragmentos del genoma (menos del 2% de éste) que contienen la información en forma de ADN necesaria para fabricar proteínas. Para ello, inicialmente deben transcribirse a ARN mensajero (o ARNm) y, posteriormente, el ARNm se traslada del núcleo celular al citoplasma, donde se traduce a proteínas. Estos procesos de transcripción y traducción están regidos por unas reglas sintácticas conocidas que indican de forma precisa cómo un nucleótido de ADN se convierte en uno de ARNm, y cómo cada tres nucleótidos de ARNm se convierten en un aminoácido de la proteína final.

Dogma central de la biología molecular (fuente).

Veamos ahora qué quiere decir la frase “los microARN regulan negativamente la expresión génica a nivel post-transcripcional”. Lo que hacen estos enanos celulares de tan solo 20 nucleótidos es enlazarse a alguno de los extremos del ARN mensajero (de ahí lo de post-transcripcional), evitando que se conviertan en proteínas (de ahí lo de regular negativamente, ya que impiden la expresión). ¿Y qué sentido tendría esto? Pues básicamente la diferenciación celular: tejidos diferentes (piel, pulmón, corazón…) expresan proteínas diferentes. Y los miARN ayudan a ello.

microARNs evitando la expresión de un ARNm (Pinterest).

Y lo cierto es que lo hacen de forma muy eficiente, ya que un mismo microARN puede “pegarse” y reprimir a muchos ARN mensajeros de distintas proteínas, desde solo unas decenas a miles de ARNm distintos. A pesar de su pequeño tamaño, los microARN controlan el destino celular de miles de genes, como si manejaran muchas marionetas con sus pequeñas manos.

Gus White (Fuente e historia).

MicroARNs en tumores

Algunos de los genes cuya expresión regulan los microARN son los denominados oncogenes. Estos son genes que suelen controlar el desarrollo y proliferación celular, es decir, que las células se dividan y crezcan los tejidos del cuerpo. Pero esta característica que es imprescindible para nuestro desarrollo se convierte en un problema cuando los oncogenes sufren mutaciones, ya que entonces las células crecen cuando no deben hacerlo, dando lugar a un crecimiento descontrolado que da lugar al tumor. Se ha observado que los microARN actúan como supresores de tumores ya que controlan la expresión de estos oncogenes, pegándose a sus ARNm y evitando que se conviertan en proteínas, y por tanto frenando el crecimiento celular y el desarrollo tumoral.

microARN pegándole una paliza a las cartas a un oncogen (Leslie jones, 1932 – fuente).

También se ha comprobado que en células tumorales disminuye la expresión de estos enanos celulares. Por ejemplo, nuestro amigo letal let-7 se encuentra en niveles muy bajos en enfermos de cáncer de pulmón, y cuanto más bajos son estos niveles más baja la tasa de supervivencia.

A la derecha la expresión relativa de let-7 en células de pulmón sanas. El resto de columnas a la izquierda muestran la expresión de distintas líneas celulares con cáncer de pulmón. Se observa claramente una disminución en la expresión de let-7 en células de pulmón tumorales (fuente).

Puede que te preguntes si, dado que los microARN regulan la expresión de los oncogenes, podrían utilizarse en terapias anticáncer. Y lo cierto es que sí, y actualmente hay varias líneas de investigación en ese sentido. Por ejemplo, el uso del microARN mir-34 como terapia para el cáncer de hígado está actualmente en fases tempranas de ensayos clínicos. Puedes encontrar una revisión reciente del uso de microARNs como terapia oncológica en este artículo.

 

He intentado explicar qué son los microARN, los enanos del genoma, y cuál es su influencia en el desarrollo de tumores. En el artículo anterior hablé de los retrotransposones, los trapecistas y escapistas del genoma, y su relación con distintos tipos de cáncer. ¿Habrá alguna relación entre estos protagonistas de nuestro circo de células tumorales?  A buscar esta relación me dedico actualmente. Espero contaros los resultados de esta investigación en cuanto pueda, para explicar si, además de trabajar en el mismo circo, trapecistas, escapistas y enanos tienen algo más en común.

Referencias

  • microRNA, the puppet master of the genome. Pamela Ajuyah and Nham Tran. The Conversation, May 2015.
  • He, L., & Hannon, G. J. (2004). MicroRNAs: Small RNAs with a big role in gene regulation. Nature Reviews Genetics, 5(7), 522–531. https://doi.org/10.1038/nrg1379
  • Zaporozhchenko, I. A., Morozkin, E. S., Ponomaryova, A. A., Rykova, E. Y., Cherdyntseva, N. V., Zheravin, A. A., Laktionov, P. P. (2018). Profiling of 179 miRNA Expression in Blood Plasma of Lung Cancer Patients and Cancer-Free Individuals. Scientific Reports, 8(1), 1–13. https://doi.org/10.1038/s41598-018-24769-2

Aunque me licencié y doctoré en Química (Cuántica), los caminos de la vida me llevaron al departamento de Lenguajes y Sistemas Informáticos de la Universitat Jaume I de Castellón. Cuando puedo escribo en mi blog sobre ciencia y escepticismo. Además de la divulgación, me apasiona el baile deportivo.



Por Guillermo Peris Ripollés
Publicado el ⌚ 10 enero, 2019
Categoría(s): ✓ Biología • Divulgación • Genética